View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_low_48 (Length: 239)
Name: NF5786_low_48
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 127 - 221
Target Start/End: Original strand, 32039224 - 32039314
Alignment:
| Q |
127 |
aaagaaaaaatatatgaattttaatcgataaaaatatgtgatacagaacatgtattgatactcttaattatagttataaaatgaaggaagtagta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
32039224 |
aaagaaaaaatatatgaattttaatcgataaaaatatgtgatacagaacatgtattgatactc----ttataattataaaatgaaggaagtagta |
32039314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 32038374 - 32038430
Alignment:
| Q |
1 |
acttgagtgatgtaagactcgaaacaactttaataactcttaataagcttttcaacc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32038374 |
acttgagtgatgtaagactcgaaacaactttaataactcttaataagcttttcaacc |
32038430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 77 - 135
Target Start/End: Original strand, 32038415 - 32038473
Alignment:
| Q |
77 |
aataagcttttcaaccttaattaaagccatgtaagctacaccaaatcttaaaagaaaaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32038415 |
aataagcttttcaaccttaattaaagtcatgtaagctacaccaaatcttaaaagaaaaa |
32038473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University