View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_low_50 (Length: 238)
Name: NF5786_low_50
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 45 - 216
Target Start/End: Complemental strand, 45063104 - 45062934
Alignment:
| Q |
45 |
aaagtgcggtaaaaaggagttgtgtggacaatgtttttgcttaaatagagaatatctcaaggctaaaaaagcatgaatatcccaagccatttaattacat |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45063104 |
aaagtgcggtaaaaaggagttgtgtggacaacgtttt-gcttaaatagagaatatctcaaggctaaaaaagcatgaatatccctagccatttaattacat |
45063006 |
T |
 |
| Q |
145 |
tgtcccttaagaaagcattcacttataaaaaggtctacactctggctgcaagaactgttgccccttctacct |
216 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45063005 |
tgtcccttaataaaacattcactcataaaaaggtctacactctggctgcaagaactgttgccccttctacct |
45062934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 218
Target Start/End: Original strand, 48491109 - 48491199
Alignment:
| Q |
128 |
aagccatttaattacattgtcccttaagaaagcattcacttataaaaaggtctacactctggctgcaagaactgttgccccttctacctga |
218 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
48491109 |
aagccatttaattacatagcccctttagaaagcattcactcataaaaaggtctactctctggctgcaagaactgttgccccttcaacctga |
48491199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University