View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5786_low_54 (Length: 227)

Name: NF5786_low_54
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5786_low_54
NF5786_low_54
[»] chr1 (1 HSPs)
chr1 (149-227)||(32038182-32038257)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 149 - 227
Target Start/End: Original strand, 32038182 - 32038257
Alignment:
149 attttaaacatgtaacaaagttaaaaaatatgtgacctttttagagaaatacacttcaatatcaatcatgcaaaccaac 227  Q
    |||||| ||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||    
32038182 attttagacatgtaacaaagttaaa---tatgtgacctttttagagaaatacacttcaatatcaatcatgcaaaccaac 32038257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University