View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_low_57 (Length: 207)
Name: NF5786_low_57
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 44380248 - 44380431
Alignment:
| Q |
1 |
cattgcactaacaacnnnnnnncaaggtagtagtaaaatttgacttgtgaagaaattaagcaaaaaagagagaatcctggaatcataaattataatgtga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44380248 |
cattgcactaacaacaaaaaaacaaggtagtagtaaaatttgacttgtgaagaaattaagcaaaaaagagagaatcctggaatcataaattataatgtga |
44380347 |
T |
 |
| Q |
101 |
gtgtgtgacacactgtgtatataatttgtttc-nnnnnnnaagcaaatatataatttgtgtctgtctatgagatattggttcta |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44380348 |
gtgtgtgacacactgtgtatataatttgtttcttttttttaagcaaatatataatttgtgtctgtctatgagatattggttcta |
44380431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University