View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5787_high_5 (Length: 268)
Name: NF5787_high_5
Description: NF5787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5787_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 26 - 243
Target Start/End: Original strand, 33112413 - 33112639
Alignment:
| Q |
26 |
tccaaacggtggtttgtttctcaatttccaaagaactaattcacc---------acctcaacctctttcacaatggaaggtggagtacataagcctgata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
33112413 |
tccaaacggtggtttgtttctcaatttccaaagaaccaattcaccacaaccaccacctcaacctctttcaaaatggaaggtgaagtacataagcctgata |
33112512 |
T |
|
| Q |
117 |
tctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacga |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33112513 |
tatcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacga |
33112612 |
T |
|
| Q |
217 |
cactggtaattacactacaaccttttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33112613 |
cactggtaattacactacaaccttttt |
33112639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 220
Target Start/End: Original strand, 33110888 - 33110946
Alignment:
| Q |
162 |
atgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacact |
220 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
33110888 |
atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatgacact |
33110946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 89 - 136
Target Start/End: Original strand, 33110829 - 33110876
Alignment:
| Q |
89 |
atggaaggtggagtacataagcctgatatctcagcttttagagaatgt |
136 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
33110829 |
atggaaggtggagtaccagaggctgatatctcagcttttagagaatgt |
33110876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 113 - 225
Target Start/End: Complemental strand, 21496836 - 21496724
Alignment:
| Q |
113 |
gatatctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggct |
212 |
Q |
| |
|
||||| || ||||| ||||||||| | || || |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
21496836 |
gatatgtctgctttcagagaatgtttatctctatcatggaaaaatccttatgttcttcgtcttgctttttctgctggaattggtggccttctttttggct |
21496737 |
T |
|
| Q |
213 |
acgacactggtaa |
225 |
Q |
| |
|
| || |||||||| |
|
|
| T |
21496736 |
atgatactggtaa |
21496724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 88 - 226
Target Start/End: Complemental strand, 21562911 - 21562773
Alignment:
| Q |
88 |
aatggaaggtggagtacataagcctgatatctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgct |
187 |
Q |
| |
|
||||||||| ||||||| | | ||||| | || ||||| ||||||||| | || || |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
21562911 |
aatggaaggaggagtacctgaagctgatgtatctgctttcagagaatgtttgtctctatcatggaaaaatccttatgttcttcgtcttgctttctctgct |
21562812 |
T |
|
| Q |
188 |
ggtattggtggccttctctttggctacgacactggtaat |
226 |
Q |
| |
|
|| |||||||| ||||||||||||| || ||||||||| |
|
|
| T |
21562811 |
ggaattggtggttttctctttggctatgatactggtaat |
21562773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 146 - 215
Target Start/End: Original strand, 51032218 - 51032287
Alignment:
| Q |
146 |
tcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacg |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
51032218 |
tcatggaaaaatccttatgttcttcgtcttgctttttctgctggaattggtggacttctttttggctacg |
51032287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University