View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5787_high_9 (Length: 238)
Name: NF5787_high_9
Description: NF5787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5787_high_9 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 35355150 - 35355370
Alignment:
| Q |
17 |
aaagactcactcttttctctttaataactatctccgtttcttttgatactgatcatcatgttctaaaatacggtttgtatacaatgtaaattttgacatt |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35355150 |
aaagacacactcttttctctttaataactatctccgtttcttttgatactgatcatcatgttctaaaatacggtttgtatacaatgtaaattttgacatt |
35355249 |
T |
|
| Q |
117 |
gtagaaaaatgcaaacaaatgcaaccgatacaggccacaataacctttaaaaccatcaaaacttaacacttttttgtattcataaaagtaaaatgttaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35355250 |
gtagaaaaatgcaaacaaatgcaaccgatacaggccacaataacctttaaaa-catcaaaacttaacacttttttgtattcataaaagtaaaatgttaga |
35355348 |
T |
|
| Q |
217 |
aatggaaaaaagtagtacaatt |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35355349 |
aatggaaaaaagtagtacaatt |
35355370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 172 - 238
Target Start/End: Complemental strand, 35343873 - 35343807
Alignment:
| Q |
172 |
tcaaaacttaacacttttttgtattcataaaagtaaaatgttagaaatggaaaaaagtagtacaatt |
238 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
35343873 |
tcaaaacttaacactcttttgtattgataaaagtaaaatgttagaaacggaaaaaagcagtacaatt |
35343807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 130
Target Start/End: Original strand, 35340301 - 35340343
Alignment:
| Q |
88 |
ggtttgtatacaatgtaaattttgacattgtagaaaaatgcaa |
130 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
35340301 |
ggtttgtatagaatgcaaattttgacattgtagaaaaatgcaa |
35340343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University