View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5788-Insertion-10 (Length: 159)
Name: NF5788-Insertion-10
Description: NF5788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5788-Insertion-10 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0147 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 18627 - 18778
Alignment:
| Q |
8 |
ctatcaatgcacggtaaaatcaaaactaaacatccaaaacattggtgtctaaatgaaataactcttgtgatgtttaacactaaagacacaataattgact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18627 |
ctatcaatgcacggtaaaatcaaaactaaacatccaaaacattggtgtctaaatgaaataactcttgtgatgtttaacactaaagacacaataattgact |
18726 |
T |
|
| Q |
108 |
aatagatgtatcaagattcaaaatccttaaaaccccttcattttgtaagatt |
159 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18727 |
aataaatgtatcaagattcaaaatccttaaaaccccttcattttgtaagatt |
18778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University