View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5788-Insertion-11 (Length: 126)
Name: NF5788-Insertion-11
Description: NF5788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5788-Insertion-11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 17587925 - 17587807
Alignment:
| Q |
8 |
ggtttgacaagaatatannnnnnnaggttcaaagttaattttatagtatgatttgtctttctctgatgcagtgacattataaattcatggacttaccatt |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17587925 |
ggtttgacaagaatatatatttttaggttcaaagttaattttatagtatgatttgtctttctctgatgcagtgacattataaattcatggacttaccatt |
17587826 |
T |
 |
| Q |
108 |
actgcaacaattgactctc |
126 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
17587825 |
actgcaccaattgactctc |
17587807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University