View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5789_low_3 (Length: 419)
Name: NF5789_low_3
Description: NF5789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5789_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 72 - 403
Target Start/End: Complemental strand, 28609991 - 28609660
Alignment:
| Q |
72 |
caaatttcaagcacttgaacaagttctcaatgaccttgaagcttcattggagaaaggcatcaaaattgaccctgaaatttatgcttctttgttagaaact |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609991 |
caaatttcaagcacttgaacaagttctcaatgaccttgaagcttcattggagaaaggcatcaaaattgaccctgaaatttatgcttctttgttagaaact |
28609892 |
T |
|
| Q |
172 |
tgttaccgtttcggagctattcatcatggtatccggcttcaccgtcttatcccaccagcccttttgcatagaaatgttggaataagttctaaacttgtta |
271 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609891 |
tgttaccgtttcggagctattcatcacggtatctggcttcaccgtcttatcccaccagcccttttgcatagaaatgttggaataagttctaaacttgtta |
28609792 |
T |
|
| Q |
272 |
ggttgtatgcttcatttgggtatatggatgatgcacatgacttgtttgatcaaatgactaagagggatatgtatgcgtttccgtggaattccttgatatc |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28609791 |
ggttgtatgcttcatttgggtatatggatgatgcacatgacttgtttgatcaaatgactaagagggatatgtatgcgtttccgtggaattcgttgatatc |
28609692 |
T |
|
| Q |
372 |
tggatatgcagagatgggtctttatgatgatg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28609691 |
tggatatgcagagatgggtctttatgatgatg |
28609660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University