View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5789_low_7 (Length: 308)
Name: NF5789_low_7
Description: NF5789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5789_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 38626327 - 38626039
Alignment:
| Q |
1 |
gtccccatatgtacatttcgtagattcttatgtagatgatgagcctcatgatccgtttgagtctcgcaccacactgcnnnnnnncagaggggggacacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38626327 |
gtccccatatgtacatttcgtagattcttatgtagatgatgagcctcatgatccgtttgagtctcgcaccacactgctttttttcagaggggggacacac |
38626228 |
T |
|
| Q |
101 |
cgtaaggatgtatgtatttatgttgatgagatttaattgaaggaataatgctgacctccttatacttacaggcaacttgatttttggggtgtgtcatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626227 |
cgtaaggatgtatgtatttatgttgatgagatttaattgaaggaataatgctgacttccttatacttacaggcaacttgatttttggggtgtgtcatgtt |
38626128 |
T |
|
| Q |
201 |
tgcagaaaggcattgttcgtgctaaattcacaaagatattagctggttttgatgatgttcactatgaaagaagttctgctacaggagaa |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626127 |
tgcagaaaggcattgttcgtgctaaattcacaaagatattagctggttttgatgatgttcactatgaaagaagttctgctacaggagaa |
38626039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University