View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5790-Insertion-2 (Length: 505)
Name: NF5790-Insertion-2
Description: NF5790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5790-Insertion-2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 462; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 8 - 481
Target Start/End: Original strand, 169954 - 170427
Alignment:
| Q |
8 |
ggatgatcatccgttggctgcctccgcggctaggtcacttgctattggaaaatgtgatgtggcgattgtgattggtgcgaggttgaattggctgcttcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
169954 |
ggatgatcatccgttggctgcctccgcggctaggtcacttgctattggaaaatgtgatgtggcgattgtgattggtgcgaggttgaattggctgcttcat |
170053 |
T |
|
| Q |
108 |
tttggggaagagccgaaatggtctaaagatgtaaagtttgtgttggtggatgtgagcaaggaagaaattgagcttagaaaaccgtttttaggtttagttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
170054 |
tttggggaagagccgaaatggtctaaagatgtaaagtttgtgttggtggatgtgagcaaggaagaaattgagcttagaaaaccgtttttagggttagttg |
170153 |
T |
|
| Q |
208 |
gtgatggtaaagaagttttggaggttttgaataaggagattaaagatgatccgttttgcttggggagtactcatccatgggtggaagctatttcgagcaa |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
170154 |
gtgatggtaaagaagttttggaggttttgaataaggagattaaagatgatccgttttgcttggggagcactcatccatgggtggaagctatttcgagcaa |
170253 |
T |
|
| Q |
308 |
agtgaaggacaatggtgtgaagatggaggctcaattggcgaaggatgttgtgccgtttaattttttgacgccgatgaggatcatcagagatgctatttcg |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
170254 |
agtgaaggacaatggtgtgaagatggaggctcaattggcgaaggatgttgtgccgtttaattttttgacgccgatgaggattatcagagatgctatttcg |
170353 |
T |
|
| Q |
408 |
gaatttggaggaagtccggctcctgtggtggtttctgaaggtgctaatactatggatgttggtcgatctgtgtt |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170354 |
gaatttggaggaagtccggctcctgtggtggtttctgaaggtgctaatactatggatgttggtcgatctgtgtt |
170427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University