View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5790-Insertion-3 (Length: 173)
Name: NF5790-Insertion-3
Description: NF5790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5790-Insertion-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 9e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 9e-47
Query Start/End: Original strand, 50 - 173
Target Start/End: Complemental strand, 33251342 - 33251219
Alignment:
| Q |
50 |
ccctttgctattgatctatcaattcttctggtttagtttttatgccattaccaataattaannnnnnnatatacttgatggtgcagcctggtcacaggta |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33251342 |
ccctttgctattgatctatcaattcttctggtttaatttttataccattaccaataattaatttttttatatacttgatggtgcagcctggtcacaggta |
33251243 |
T |
|
| Q |
150 |
ctattacccacatcatccatatca |
173 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33251242 |
ctattacccacatcatccatatca |
33251219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 118 - 161
Target Start/End: Complemental strand, 1617136 - 1617093
Alignment:
| Q |
118 |
atatacttgatggtgcagcctggtcacaggtactattacccaca |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1617136 |
atatacttgatggtgcagcctaatcacaggtactattacccaca |
1617093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University