View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5790_high_15 (Length: 223)
Name: NF5790_high_15
Description: NF5790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5790_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 38854055 - 38853963
Alignment:
| Q |
1 |
ataataagtggtacaaatagattactcattttgttaact----ttagtattttctcacttggatttggtacaagttgattattcgtcatatgt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38854055 |
ataataagtggtacaaatagattactcattttgttaactgcctttagtattttctcacttggatttggtacaagttgattattcatcatatgt |
38853963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 45454847 - 45454759
Alignment:
| Q |
1 |
ataataagtggtacaaatagattactcattttgttaact----ttagtattttctcacttggatttggtacaagttgattattcgtcat |
85 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
45454847 |
ataataagtagtactaatagattactcattttgttaactgcctttattattttctcacttggatttagtacaaattgattattggtcat |
45454759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University