View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5790_low_12 (Length: 314)

Name: NF5790_low_12
Description: NF5790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5790_low_12
NF5790_low_12
[»] chr5 (2 HSPs)
chr5 (89-300)||(18246298-18246509)
chr5 (6-43)||(18246552-18246589)


Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 89 - 300
Target Start/End: Complemental strand, 18246509 - 18246298
Alignment:
89 atgcatatggtatatgaaaaccttggatctctctctatcaacacaaactatgttgttgtttcaagtttagacaaagagagtaaaaatagctatgcctata 188  Q
    |||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||    
18246509 atgcatatggtatatgcagaccttggatctctctctatcaacacaaactatggtgttgtttcaagtttagacaaagagagtaaaaatagctatgccttta 18246410  T
189 agagctttgtgatggagaatagtagtgtctttccatttatgagtgagtgtctttccaaaagatatgaagaaaataacatggatgatgatatggaaggaaa 288  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
18246409 agagctttgtgatggagaatggtagtgtctttccatttatgagtgagtgtctttccaaaagatatgaagaacataacatggatgatgatatggaaggaaa 18246310  T
289 aggttcttattg 300  Q
    ||||||||||||    
18246309 aggttcttattg 18246298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 18246589 - 18246552
Alignment:
6 agtgagatgaactcatgatctcttcacaagaaaaccaa 43  Q
    ||||| ||||||||||||||||||||||||||||||||    
18246589 agtgaaatgaactcatgatctcttcacaagaaaaccaa 18246552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University