View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5790_low_20 (Length: 221)
Name: NF5790_low_20
Description: NF5790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5790_low_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 30 - 221
Target Start/End: Complemental strand, 54239219 - 54239029
Alignment:
| Q |
30 |
atacatgcagtcaatttgccaacatcacatattcatgattatgattcgttaatggcgtaaaacattttatagtgacaaagctaaactcataaactgtaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54239219 |
atacatgcagtcaatttgccaacatcacatattcatgattatgattcgttaatggcgtaaaacattttatagtgacaaagctaaactcataaactgtaat |
54239120 |
T |
|
| Q |
130 |
caatt-gnnnnnnnnnagtcatttggaaagaattatatcatactgttctggacgacatgacctattcatgcattataactatacacctctaaa |
221 |
Q |
| |
|
||||| | ||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54239119 |
caattggtttttttttagtcatttggaaagaat--tttcatactgttctgaacgacatgacctattcatgcattataactatacacctttaaa |
54239029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University