View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794-Insertion-11 (Length: 161)
Name: NF5794-Insertion-11
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794-Insertion-11 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 5e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 31658968 - 31659121
Alignment:
| Q |
8 |
atatatagtgatcaagcttttttatttaagaaatacaataccttatggatggttttagtttatttgaacttaacaattattcgggatgacaacattacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658968 |
atatatagtgatcaagcttttttatttaagaaatacaataccttatggatggttttagtttatttgaacttaacaattattcgggatgacaacattacaa |
31659067 |
T |
|
| Q |
108 |
gcactagcaacctctctagctctaggagagttaacatattgactgtaatctggg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31659068 |
gcactagcaacctctctagctctaggagagttaacatattgactgtaatctggg |
31659121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 55 - 148
Target Start/End: Original strand, 31671749 - 31671839
Alignment:
| Q |
55 |
gatggttttagtttatttgaacttaacaattattcgggatgacaacattacaagcactagcaacctctctagctctaggagagttaacatattg |
148 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| |||||||||||||| ||||||||||||||| | ||| | |||||||||||||||||| |
|
|
| T |
31671749 |
gatggttttagtttacttgaacttaaca---atttgggatgacaacattgcaagcactagcaacccttttagaaccaggagagttaacatattg |
31671839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University