View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5794-Insertion-11 (Length: 161)

Name: NF5794-Insertion-11
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5794-Insertion-11
NF5794-Insertion-11
[»] chr7 (2 HSPs)
chr7 (8-161)||(31658968-31659121)
chr7 (55-148)||(31671749-31671839)


Alignment Details
Target: chr7 (Bit Score: 154; Significance: 5e-82; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 31658968 - 31659121
Alignment:
8 atatatagtgatcaagcttttttatttaagaaatacaataccttatggatggttttagtttatttgaacttaacaattattcgggatgacaacattacaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31658968 atatatagtgatcaagcttttttatttaagaaatacaataccttatggatggttttagtttatttgaacttaacaattattcgggatgacaacattacaa 31659067  T
108 gcactagcaacctctctagctctaggagagttaacatattgactgtaatctggg 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31659068 gcactagcaacctctctagctctaggagagttaacatattgactgtaatctggg 31659121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 55 - 148
Target Start/End: Original strand, 31671749 - 31671839
Alignment:
55 gatggttttagtttatttgaacttaacaattattcgggatgacaacattacaagcactagcaacctctctagctctaggagagttaacatattg 148  Q
    ||||||||||||||| ||||||||||||   ||| |||||||||||||| |||||||||||||||  | |||  | ||||||||||||||||||    
31671749 gatggttttagtttacttgaacttaaca---atttgggatgacaacattgcaagcactagcaacccttttagaaccaggagagttaacatattg 31671839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University