View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794-Insertion-15 (Length: 87)
Name: NF5794-Insertion-15
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794-Insertion-15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 32265908 - 32265987
Alignment:
| Q |
8 |
ctaatgcttgtcctgacctgaaaattttataacaaattggacattcatattctttgcttttctttgacttcaacttcttc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265908 |
ctaatgcttgtcctgacctgaaaattttgtagcaaattggacattcatattctttgcttttctttgacttcaacttcttc |
32265987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 8 - 79
Target Start/End: Original strand, 19300435 - 19300506
Alignment:
| Q |
8 |
ctaatgcttgtcctgacctgaaaattttataacaaattggacattcatattctttgcttttctttgacttca |
79 |
Q |
| |
|
|||| |||||||||||| ||||||| || | |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19300435 |
ctaaagcttgtcctgacttgaaaatcttgttgcaaattggacattcatgttctttgcttttctttgacttca |
19300506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University