View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794-Insertion-17 (Length: 64)
Name: NF5794-Insertion-17
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794-Insertion-17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 46; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 15281204 - 15281249
Alignment:
| Q |
8 |
gaaagaaatagaggtcaatgctgtgattacttgttccacatctcct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15281204 |
gaaagaaatagaggtcaatgctgtgattacttgttccacatctcct |
15281249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 57
Target Start/End: Complemental strand, 43721342 - 43721297
Alignment:
| Q |
12 |
gaaatagaggtcaatgctgtgattacttgttccacatctcctaaaa |
57 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
43721342 |
gaaatagaggccaatgttgtgattatttgttccacatctgctaaaa |
43721297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University