View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794-Insertion-9 (Length: 218)
Name: NF5794-Insertion-9
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794-Insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 31259155 - 31258969
Alignment:
| Q |
8 |
aataatacatttgatcttcaaattaataggttataataaatgagttttgcagaaatataataatacatacttatttgtgagacttatttagtaaatattt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31259155 |
aataatacatttgatcttcaaattaataggttataataaatgagttttgcagaaatataataatacataattatttgtgagactgatttagtaaatattt |
31259056 |
T |
 |
| Q |
108 |
ataaggtgctagattgaagagattgtgtacttttcttttaaaaggggatcaatagtcttatccacctctatctacccctcatgactc |
194 |
Q |
| |
|
||| | |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31259055 |
atacgatgctagattggagagattgtgtacttttcttttaaaaggggaccaatagtcttatccacttctatctacccctcatgactc |
31258969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University