View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_high_6 (Length: 331)
Name: NF5794_1D_high_6
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_high_6 |
 | |
|
| [»] scaffold0856 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0856 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 10 - 309
Target Start/End: Original strand, 4293 - 4593
Alignment:
| Q |
10 |
ctggtagtgaatgaacttgttggttgaggtttggagacatgttgactcaattgtcggatggtgaaagagataactgaccaggtagtaggttaagtataca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4293 |
ctggtagtgaatgaacttgttggttgaggtttggagacatgttgactcaattgtcggatggtgaaagagataactgaccaggtagtaggttaagtataca |
4392 |
T |
|
| Q |
110 |
attcatctacacttggattcatgatcatcaaatacaaatcatgtttcaactcaacccactgccgaaccgattctttgtcaatctgcatccattgtaggct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4393 |
attcatctacacttggattcatgatcatcaaatacaaatcatgtttcaactcaacccactgccgaaccggttctttgtcaatctgcatccattgtaggct |
4492 |
T |
|
| Q |
210 |
aggacatatttctaattaagattctacctcctccctatggctacctctctcta-gtccctcttcattgtaattttcctgatgattctactacctccttcc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4493 |
aggacatatttctaattaagattctacctcctccctatggctacctctctctaggtccctcttcattgtaattttcctgatgattctactacctccttcc |
4592 |
T |
|
| Q |
309 |
t |
309 |
Q |
| |
|
| |
|
|
| T |
4593 |
t |
4593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 309
Target Start/End: Complemental strand, 30272962 - 30272888
Alignment:
| Q |
238 |
tcctccctatggctacctc--tctcta-gtccctcttcattgtaattttcctgatgattctactacctccttcct |
309 |
Q |
| |
|
|||||||||||||| ||| |||||| |||| ||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
30272962 |
tcctccctatggctctctccctctctatgtccttcttcattgtaatcttcctgatgattcttctacctccttcct |
30272888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University