View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_high_7 (Length: 292)
Name: NF5794_1D_high_7
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 24 - 290
Target Start/End: Complemental strand, 47254889 - 47254625
Alignment:
| Q |
24 |
tgtctgaaaccgctctttctgtcaaaatttccgaccaaatctcattcctatataaacaacatgtcactgtctcatttcttcatctcttccatcatcatag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47254889 |
tgtctgaaaccgctctttctgtcaaaatttccgaccaaatctcattcctatataaacaccatgtcact--ctcatttcttcatctcttccatcatcatag |
47254792 |
T |
|
| Q |
124 |
ttcacaaacccttatctctccttcaacctgagctgagatggagactcgtgcttcaaagaagagggctaacgctgaaccaattgttcttaacaataagaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254791 |
ttcacaaacccttatctctccttcaatctgagctgagatggagactcctgcttcaaagaagagggctaacgctgaaccaattgttcttaacaataagaaa |
47254692 |
T |
|
| Q |
224 |
caaagggttgttttgggtgatcttcccaatttaccaaatctcaatgtttctccaaaacaccaaactc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
47254691 |
caaagggttgttttgggtgatcttcccaatttaccaaatctcaatgtttctcccaaaccccaaactc |
47254625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University