View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_low_16 (Length: 266)
Name: NF5794_1D_low_16
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 13637439 - 13637215
Alignment:
| Q |
9 |
ttggatcaaaataaactctctcaagaagaaactttgctttcctttttccaaattacaatatgattttgaatgttggtgtaaaaatttgtaatttattttt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13637439 |
ttggatcaaaataaactctctcaagaagaaactttgctttcctttttccaaattacaatatgaatttgaatgttggtgtaaaaatttgtaatttattttt |
13637340 |
T |
|
| Q |
109 |
tgtcactcaatcaatatgaatttccaacaaaatctaacagacaatatagtaataaactaataaaccttattctgatatgaaatttgtaaagcctagtata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
13637339 |
tgtcactcaatcaatatgaatttccaacaaaatctatcagacaatatagtaat--------aaaccttattctgatatgaaa---gtaaaccctagtata |
13637251 |
T |
|
| Q |
209 |
tcatgcataaaattaccttatctttaatgaatgctg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13637250 |
tcatgcataaaattaccttatctttaatgaatgctg |
13637215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 47 - 88
Target Start/End: Complemental strand, 14737156 - 14737115
Alignment:
| Q |
47 |
ttcctttttccaaattacaatatgattttgaatgttggtgta |
88 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14737156 |
ttcctttttccaaaatacaatatgaagttgaatgttggtgta |
14737115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 47 - 88
Target Start/End: Complemental strand, 14743723 - 14743682
Alignment:
| Q |
47 |
ttcctttttccaaattacaatatgattttgaatgttggtgta |
88 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14743723 |
ttcctttttccaaaatacaatatgaagttgaatgttggtgta |
14743682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University