View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_low_17 (Length: 265)
Name: NF5794_1D_low_17
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 126 - 246
Target Start/End: Complemental strand, 3798236 - 3798116
Alignment:
| Q |
126 |
agaacctgtgagaattgcataagggggttaacatgtccttgaactggaaatggtataacaagaaaatgaggcaatatactcatttgctttgttgctagct |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3798236 |
agaacttgtgagaattgcataagggggttaacatgtccttgaactggaaatggtataacaagaaaatgaggcaatatactcatttgctttgttgctagct |
3798137 |
T |
|
| Q |
226 |
agaaaataattatattattat |
246 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3798136 |
agaaaataattatattattat |
3798116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 132 - 244
Target Start/End: Original strand, 3791127 - 3791235
Alignment:
| Q |
132 |
tgtgagaattgcataagggggttaacatgtccttgaactggaaatggtataacaagaaaatgaggcaatatactcatttgctttgttgctagctagaaaa |
231 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||| ||| ||| ||||| |
|
|
| T |
3791127 |
tgtgagaattgcataaggggattcacatgtccttgaactggatatggtatagcaagaaaatgaggcaatataaccatttgcttagtt----gctggaaaa |
3791222 |
T |
|
| Q |
232 |
taattatattatt |
244 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3791223 |
taattatattatt |
3791235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 24 - 112
Target Start/End: Original strand, 18542190 - 18542278
Alignment:
| Q |
24 |
acccccgggtggaagttggacaagccatggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18542190 |
acccccgggtggaagttggacaagccatggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaggcacaggaggaaatg |
18542278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 54 - 112
Target Start/End: Original strand, 18555277 - 18555335
Alignment:
| Q |
54 |
agtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18555277 |
agtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaggcacaggaggaaatg |
18555335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 96
Target Start/End: Original strand, 18550295 - 18550341
Alignment:
| Q |
50 |
atggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatca |
96 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18550295 |
atggagtaaaaggaaatggtggtaaaggaggatcaaagggtggatca |
18550341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University