View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_low_24 (Length: 242)
Name: NF5794_1D_low_24
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_low_24 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 47800169 - 47800410
Alignment:
| Q |
1 |
aatctaagacaagcaataatttacctaagttaaggacttttcttacacgaatcagaggtatagagatgattgtgtagtggatggaatcaagagataacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47800169 |
aatctaagacaagcaataatttacctaagttaaggacttttcttacacgaatcagaggtatagagatgattgtgtagtggatggaatcaagagataacga |
47800268 |
T |
|
| Q |
101 |
tatgaatgtctgaaggttatctgtttgcaggtctgaatctatttgtttatttgataaaattcaaaggttaaccgccgagaaggagttaactatatgttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47800269 |
tatgaatgtctgaaggttatctgtttgcaggtctgaatctatttgtttatttgataaaattcaaaggttaaccgccgagaaggagttaactatatgttat |
47800368 |
T |
|
| Q |
201 |
catagttatgagcgacaaccttgaaacaactgtatatgatga |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47800369 |
catagttatgagcgacagccttgaaacaactgtatatgatga |
47800410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 82 - 172
Target Start/End: Original strand, 48755583 - 48755673
Alignment:
| Q |
82 |
tggaatcaagagataacgatatgaatgtctgaaggttatctgtttgcaggtctgaatctatttgtttatttgataaaattcaaaggttaac |
172 |
Q |
| |
|
|||||||||||||||| | || ||| ||||||| |||||| |||||||||||||| |||||| || ||||||||||| |||| |||||| |
|
|
| T |
48755583 |
tggaatcaagagataaaggtaggaaggtctgaatcttatctatttgcaggtctgaaactatttacttgtttgataaaatgcaaaagttaac |
48755673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University