View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_low_27 (Length: 230)
Name: NF5794_1D_low_27
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 23975815 - 23975601
Alignment:
| Q |
7 |
gtagtatgagcctataggttggtttgctgtgaacaaagcatcaaccgtttggccaggggcgataacgatgacgtcggtcttgaatggatcggtgtagtca |
106 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||| |||||||| ||||||||| |
|
|
| T |
23975815 |
gtagtaagatcctataggttgatttgctgtgaacaaagcatcaactgtttggccaggggcgataacgatgatgtcagtctcgaatggattcgtgtagtca |
23975716 |
T |
 |
| Q |
107 |
gcatctagtgcaacaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagtatgtcatccctg |
206 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
23975715 |
gcatccagtgcaacaactgtgaaactgtgatttgctattttgaagaaaagattgttattgagtgcaacattgattatccgtagcaagtatgtcatccctg |
23975616 |
T |
 |
| Q |
207 |
gtttcaccttcatct |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23975615 |
gtttcaccttcatct |
23975601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 195
Target Start/End: Complemental strand, 6026172 - 6026096
Alignment:
| Q |
119 |
acaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagta |
195 |
Q |
| |
|
|||||||||||| | || |||||||| ||||||||| | || | |||||||||| ||||||| || ||||||||||| |
|
|
| T |
6026172 |
acaactgtgaaactatggtttgctatcttgaagaaatgttgttcattgagtgcagcattgataatgcgtagtaagta |
6026096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University