View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_low_28 (Length: 228)
Name: NF5794_1D_low_28
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 112 - 222
Target Start/End: Complemental strand, 40812570 - 40812456
Alignment:
| Q |
112 |
atcaaattatttctaatctatataaaggagatacaatgtgcccttgttgtggtacaatgtagaaagaac----gatgttattttatgggatgtgcagcat |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40812570 |
atcaaattatttctaatctttataaaggagatacaatgtgcccttgttgtggtacaatgtagaaagaacgaatgatgttattttatgggatgtgcagcat |
40812471 |
T |
 |
| Q |
208 |
agctatggtattttg |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40812470 |
agctatggtattttg |
40812456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 20470579 - 20470543
Alignment:
| Q |
26 |
agatgcagtaaaacttaagcatcaatcaacctaatat |
62 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20470579 |
agatgcagtaaaactttagcatcaatcaacctaatat |
20470543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University