View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_low_30 (Length: 223)
Name: NF5794_1D_low_30
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 36891018 - 36890952
Alignment:
| Q |
1 |
acacatgtatatgtacttacagtggtataggattcgcttataccatgaaaggttgcttgcacttttg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36891018 |
acacatgtatatgtacttacagtggtataggattcgcttataccatgaaaggttgcttgcacttttg |
36890952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 13 - 67
Target Start/End: Complemental strand, 36877939 - 36877885
Alignment:
| Q |
13 |
gtacttacagtggtataggattcgcttataccatgaaaggttgcttgcacttttg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36877939 |
gtacttacagtggtataggattcgcttataccatgaaaggttgcttgcacttttg |
36877885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 216
Target Start/End: Original strand, 11615791 - 11615899
Alignment:
| Q |
108 |
aacttgaaaacgtgtctccgatgaaaagtcggtgttataataactcttgattctggactagtatgatagccatgtagttgaagatgtatgctaaccatgc |
207 |
Q |
| |
|
|||||||||| ||||||| | ||| |||| ||| | ||| ||||||||||||| || ||| || |||| ||||||||| || ||| |||||||||| |
|
|
| T |
11615791 |
aacttgaaaaggtgtctcttaagaagagtcagtgctgtaacaactcttgattctctaccagtgtggtagcgatgtagttgcagctgtgagctaaccatgt |
11615890 |
T |
|
| Q |
208 |
ctgcaataa |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
11615891 |
ctgcaataa |
11615899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University