View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_1D_low_35 (Length: 208)
Name: NF5794_1D_low_35
Description: NF5794_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_1D_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 35071631 - 35071431
Alignment:
| Q |
1 |
tcaattattattgatgtccatgtatgtaatccgtacttcatagattaattggtttgtataaaaatggaggagatttcaggtcacaggaatgacattggtc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35071631 |
tcaattattattaatgtccatgtatgta-tccgtacttcatagattaattggtttgtataaaaatggaggagatttcaggtcacgagaatgacattggtc |
35071533 |
T |
 |
| Q |
101 |
accggatctgaaatcaacggtgtcttgtaaaattctgttctatgcttttcattaaaactgaagctcaatcttgagattttgtattattgtctagtttcat |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
35071532 |
accggatctgaaatcaactgtgtcttgtaaaattctgttctatgcttttcattaaaactgaagcacaatcttgagattttgtattattgtctagttttat |
35071433 |
T |
 |
| Q |
201 |
ct |
202 |
Q |
| |
|
|| |
|
|
| T |
35071432 |
ct |
35071431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University