View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_2D_high_4 (Length: 502)
Name: NF5794_2D_high_4
Description: NF5794_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_2D_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 133 - 485
Target Start/End: Original strand, 15288441 - 15288793
Alignment:
| Q |
133 |
gattttggttcaagtctttttaccttgagtgagtcagttgaatcggtgactgattgatgtgtatagccgttgaaatcgaaatcatcttcgtcggagctgt |
232 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288441 |
gattttggttcaagtttttttaccttgagtgagtcagttgaatcggtgactgattcatgtgtatagccgttgaaatcgaaatcatcttcgtcggagctgt |
15288540 |
T |
|
| Q |
233 |
tagcgttgaagcagttacagcggttacgagacggtggttgaagttgcggttgcggttgttcttccatgaaactctgaaccattttcgccaagcaaacaga |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15288541 |
tagcgttgaagcagttacagcggttacgagacggtggttgaagttgcggttgcggttgttcttccatgaaactttgaaccattttcgccaagcaaacaga |
15288640 |
T |
|
| Q |
333 |
gcttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttctcgaaagcgaaaaacctcttcaacctccatttc |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15288641 |
gcttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttctcgaaagcgaaaaacctcttcaacctccacttc |
15288740 |
T |
|
| Q |
433 |
gaaactggttcatttcgaaccagttccgtagtggctttctctgaatcgatgtc |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15288741 |
gaaactggttcatttcgaaccagttccgtagtggctttctctgaatctatgtc |
15288793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University