View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_high_17 (Length: 317)
Name: NF5794_high_17
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 32265400 - 32265528
Alignment:
| Q |
13 |
aatattgatatcgctgaaaaagaaaaacatgtccaatggaatattgattgaaccaatgaaaggaaaggtgaaacaaaaatttcaatggaatgaagaaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32265400 |
aatattgatatcgctgaaaaagaaaaacatgtccaatggaatattgattgaatcaatgaaa-----ggtgaaacaaaaatttcaatggaatgaagaaact |
32265494 |
T |
 |
| Q |
113 |
atgaaattgtcatgttccattattaacatgaaag |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32265495 |
atgaaattgtcatgttccattattaacatgaaag |
32265528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 211 - 271
Target Start/End: Original strand, 32265594 - 32265654
Alignment:
| Q |
211 |
tcattaacccacatggctttctgtacattgcaaatgctttcatcatatgtgataatgccaa |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265594 |
tcattaacccacatggctttctgtacattgcaaatgctttcatcatatgtgataatgccaa |
32265654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University