View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_high_26 (Length: 260)
Name: NF5794_high_26
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_high_26 |
 |  |
|
| [»] chr2 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 112 - 260
Target Start/End: Complemental strand, 13637439 - 13637291
Alignment:
| Q |
112 |
ttggatcaaaataaactctctcaagaagaaactttgctttcctttttccaaattacaatatgattttgaatgttggtgtaaaaatttgtaatttattttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13637439 |
ttggatcaaaataaactctctcaagaagaaactttgctttcctttttccaaattacaatatgaatttgaatgttggtgtaaaaatttgtaatttattttt |
13637340 |
T |
 |
| Q |
212 |
tgtcactcaatcaatatgaatttccaacaaaatctaacagacaatatag |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13637339 |
tgtcactcaatcaatatgaatttccaacaaaatctatcagacaatatag |
13637291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 13627461 - 13627421
Alignment:
| Q |
10 |
attattctatatattaaatgtgatagatttgaagtactatt |
50 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13627461 |
attattttatatattaaatgtgatagatttgaagtactatt |
13627421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 191
Target Start/End: Complemental strand, 14737156 - 14737115
Alignment:
| Q |
150 |
ttcctttttccaaattacaatatgattttgaatgttggtgta |
191 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14737156 |
ttcctttttccaaaatacaatatgaagttgaatgttggtgta |
14737115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 191
Target Start/End: Complemental strand, 14743723 - 14743682
Alignment:
| Q |
150 |
ttcctttttccaaattacaatatgattttgaatgttggtgta |
191 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14743723 |
ttcctttttccaaaatacaatatgaagttgaatgttggtgta |
14743682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University