View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_low_15 (Length: 334)
Name: NF5794_low_15
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 17 - 302
Target Start/End: Complemental strand, 45404043 - 45403758
Alignment:
| Q |
17 |
catcatgagtgtccaatttgctttaaggtttttcaatctggtcaagccttaggtggacataaaagatctcatattgttgctactgcttctgagagtagag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45404043 |
catcatgagtgtccaatttgctttaaggtttttcaatctggtcaagccttaggtggacataaaagatctcatattgttgctactggttctgagagtagag |
45403944 |
T |
 |
| Q |
117 |
ttgtacttgaggaacaagttccacagattagggactttcttgatcttaatcttcctgctgctactgaggaagaaagtaacagtcatgctgattctaacag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403943 |
ttgtacttgaggaacaagttccacagattagggactttcttgatcttaatcttcctgctgctactgaggaagaaagtaacagtcatgctgattctaacag |
45403844 |
T |
 |
| Q |
217 |
accttggtggatagttgaaggcaaccataatcaagaggcactggtagggtagggactcatatctagctaaacttcataagagtgaa |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403843 |
accttggtggatagttgaaggcaaccataatcaagaggcactggtagggtagggactcatatctagctaaacttcataagagtgaa |
45403758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University