View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_low_23 (Length: 292)
Name: NF5794_low_23
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 12 - 286
Target Start/End: Original strand, 47520780 - 47521054
Alignment:
| Q |
12 |
atgaacaaacgtggtgattgtatgagattaaatggcgatgaaatcgaatgcaggcctgctgcatatttcttccttggaagagtcaaatggtttaatagat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
47520780 |
atgaacaaacgtggtgattgtatgagattaaatggcgatgaaatcgaatgcaggcctgctgcatacttcttccttggaagggtcaaatggtttaatagat |
47520879 |
T |
 |
| Q |
112 |
ttgaggatgaaaatgaaggcggtgttttgtaattgaagttgcccggaaaccatcattgaattttgttgattttaattgttagagaaagcggggtttgttg |
211 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47520880 |
ttgagtatgaaaatgaaggtggtgttttgtaattgaagttgcccggaaaccatcattgagttttgttgattttaattgttagagaaagcggggtttgttg |
47520979 |
T |
 |
| Q |
212 |
atgtggtgaatatttggacttatacatcttccaaaaacggcaattgaaggatgttaattgattgaaattggtata |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47520980 |
atgtggtgaatatttggacttatacatcttccaaaaacggcaattgaaggatgctaattgattgaaattggtata |
47521054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University