View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_low_26 (Length: 261)
Name: NF5794_low_26
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 37823670 - 37823888
Alignment:
| Q |
18 |
caaacttgcattgcttttttcttctaagctagtgttaaacagaccattgaacccgactctgcttccaagcactgctgtttttgttaaacctgttttagcg |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
37823670 |
caaacttgcattgcttttttcttccaagctagtgataaacagaccattgaacccgactctgcttccaagcactgctgttttagt---------------g |
37823754 |
T |
 |
| Q |
118 |
aaggctgaatagtttagtttaacatgacacaactaatgagccaacattatggtagcatttttatttattatttaacaaacctttgaatcaagtaattttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37823755 |
aaggctgaatagtttagtttaacatgacacaactaatgagccaacattatggtagcatttttatttattatttaacaaacctttgaatcaagtaattttc |
37823854 |
T |
 |
| Q |
218 |
atttctcaagtttaaaaattaagttttgcctatg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37823855 |
atttctcaagtttaaaaattaagttttgcctatg |
37823888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 47597430 - 47597385
Alignment:
| Q |
20 |
aacttgcattgcttttttcttctaagctagtgttaaacagaccatt |
65 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
47597430 |
aacttgcattgcttttttcttccaagttagtgataaacagaccatt |
47597385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University