View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5794_low_31 (Length: 250)
Name: NF5794_low_31
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5794_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 129 - 236
Target Start/End: Complemental strand, 51875991 - 51875884
Alignment:
| Q |
129 |
gatattaaataattgaatgttgtattccatacaaaatgaaactctaggtatcgaggtattcatctaattttaatttgacagttcaaatcaagaggatgat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51875991 |
gatattaaataattgaatgttgtattccatacaaaatgaaactctaggtattgaggtattcatctaattttaatttgacagttcaaatcaagaggatgat |
51875892 |
T |
 |
| Q |
229 |
tcctaact |
236 |
Q |
| |
|
|||||||| |
|
|
| T |
51875891 |
tcctaact |
51875884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 5 - 68
Target Start/End: Complemental strand, 51876115 - 51876052
Alignment:
| Q |
5 |
tacacttaattttaagaaaattcttaggtggcttgagttttgatggatagcggttctcatgtag |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51876115 |
tacacttaattttaagaaaattcttaggtggcttgagttttgatggatagcggttctcatgtag |
51876052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University