View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5794_low_39 (Length: 242)

Name: NF5794_low_39
Description: NF5794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5794_low_39
NF5794_low_39
[»] chr7 (1 HSPs)
chr7 (19-233)||(23975601-23975815)
[»] chr4 (1 HSPs)
chr4 (131-207)||(6026096-6026172)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 23975815 - 23975601
Alignment:
19 gtagtatgagcctataggttggtttgctgtgaacaaagcatcaaccgtttggccaggggcgataacgatgacgtcggtcttgaatggatcggtgtagtca 118  Q
    |||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||| ||||||||  |||||||||    
23975815 gtagtaagatcctataggttgatttgctgtgaacaaagcatcaactgtttggccaggggcgataacgatgatgtcagtctcgaatggattcgtgtagtca 23975716  T
119 gcatctagtgcaacaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagtatgtcatccctg 218  Q
    ||||| |||||||||||||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||| ||||| ||||||||||||||||    
23975715 gcatccagtgcaacaactgtgaaactgtgatttgctattttgaagaaaagattgttattgagtgcaacattgattatccgtagcaagtatgtcatccctg 23975616  T
219 gtttcaccttcatct 233  Q
    |||||||||||||||    
23975615 gtttcaccttcatct 23975601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 207
Target Start/End: Complemental strand, 6026172 - 6026096
Alignment:
131 acaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagta 207  Q
    |||||||||||| | || |||||||| ||||||||| | || | |||||||||| ||||||| || |||||||||||    
6026172 acaactgtgaaactatggtttgctatcttgaagaaatgttgttcattgagtgcagcattgataatgcgtagtaagta 6026096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University