View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5795-Insertion-12 (Length: 199)
Name: NF5795-Insertion-12
Description: NF5795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5795-Insertion-12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 191
Target Start/End: Original strand, 37173406 - 37173586
Alignment:
| Q |
11 |
tatcatatcatatgtatatgttactattatgtattcatctcttatctcacatggttccaaaatatatttgaattaggaagcatgcaagcataagggtcta |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173406 |
tatcatatcatatgtgtatgttactattatgtattcatctcttatctcacatggttccaaaatatatttgaattaggaagcatgcaagcataagggtcta |
37173505 |
T |
|
| Q |
111 |
tatttgtataactatgctggatgtgtatggaagaagagtgaagtccaagtagtctttatttattaatgttatgtttttgcg |
191 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
37173506 |
tctttgtataactatgctggatgtgtatggaagaagagtgaagtccaagcattctttatttattaatgttatgtttttgcg |
37173586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University