View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5795-Insertion-13 (Length: 245)
Name: NF5795-Insertion-13
Description: NF5795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5795-Insertion-13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 200
Target Start/End: Complemental strand, 27129920 - 27129729
Alignment:
| Q |
9 |
tcaggaacaggtgctgccattgaatatgcagtcgtacatttaaaggtaagtaaatagacagcattcttcttttccctataatgagatgggtcacatatgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27129920 |
tcaggaacaggtgctgccattgaatatgcagtcgtacatttaaaggtaaataaatagacagcattcttcttttccctataatgagatgggtcacatatgc |
27129821 |
T |
 |
| Q |
109 |
atgtgaaaactagctagtactagttagtttggtggtggaacatgtttccttttctcttgcatatccccacttttgagtctacctttagggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27129820 |
atgtgaaaactagctagtactagttagtttggtggtggaacatgtttccttttctcttgcatatccccacttttgagtctacctttggggta |
27129729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 27129202 - 27129159
Alignment:
| Q |
194 |
tagggtacgtttattatttttta-aaacataactgtaatttttt |
236 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27129202 |
tagggtacgtttattatttttttcaaacataactgtaatttttt |
27129159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University