View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5797-Insertion-15 (Length: 295)
Name: NF5797-Insertion-15
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5797-Insertion-15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 8 - 292
Target Start/End: Complemental strand, 2482173 - 2481891
Alignment:
| Q |
8 |
attttcctagcaccctaatacgtatatgattatacaatatcaatggaaaatatgggtgttctataaatgcagcacatcaggcctcacccgttacattaac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2482173 |
attttcctagcaccctaatacgtatatga--atacaatatcaatggaaaatatgggtgttctataaatgcagcaaatcaggcctcacccgttacgttaat |
2482076 |
T |
 |
| Q |
108 |
tacaacaaccaatcaggatttggatacaaataatcatcaagaaggggacgaacttgcagagaatacatttatccgatacatgtgacatatgcagagagtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2482075 |
tacaacaaccaatcaggatttggatacaaataatcatcacgaaggggacgaacttgcagagaatacatttatccgatacatgtgacatatgcagagagtt |
2481976 |
T |
 |
| Q |
208 |
agctacggaaattaaattccagtggttaagccacaaaagtataactctgcaggtactacttgtatagatgggcaagagtgtgtgt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2481975 |
agctacggaaattaaattccagtggttaagccacaaaagtataactctgcaggtactacttgtatagatgggcaagagtgtgtgt |
2481891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University