View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5797-Insertion-16 (Length: 253)
Name: NF5797-Insertion-16
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5797-Insertion-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 253
Target Start/End: Original strand, 3674241 - 3674488
Alignment:
| Q |
9 |
ctatacacatcactctttgttgtgaggtgacctatata--atcaatcgggcaagggttaattagattnnnnnnnnnntt-cttcttcttaaccctcaaat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||| |||||||||| |||| |
|
|
| T |
3674241 |
ctatacacatcactctttgttgtgaggtgacctatatataatcaatcgggcaagggttaattagattcaaatttttttttcttcgtcttaaccctaaaat |
3674340 |
T |
|
| Q |
106 |
tatcagcgaaaacaaccctgataatctagagttcggccaggagcagcataaaacagggttaacattttgtatggtagagtcatacctgtcatgatgtact |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3674341 |
tatcagcgaaaacaatcctgataatctagagttcggccaggagcagcataaaacagggttaacattttgtatggtagagtcatacctgtcatgatgtact |
3674440 |
T |
|
| Q |
206 |
caggagccgcataaccatgtgttcccattacgcgtgtcgttacatgtg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3674441 |
caggagccgcataaccatgtgttcccattacgcgtgtcgttacatgtg |
3674488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University