View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5797-Insertion-19 (Length: 171)
Name: NF5797-Insertion-19
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5797-Insertion-19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 8e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 8e-78
Query Start/End: Original strand, 9 - 171
Target Start/End: Complemental strand, 13140222 - 13140060
Alignment:
| Q |
9 |
catgcatggtgtagcaaagatatgtgcttatgactcaaggcaattttcgaaagaaatcatgggaatgagtgttttggccatgactgtaattgtgatctgt |
108 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13140222 |
catgcatggtgtagcaaatagatgtgcttatgactcaaggcatttttcgaaagaaatcatgggaatgagtgttttggccatgattgtaattgtgatctgt |
13140123 |
T |
 |
| Q |
109 |
ttgccagaaccaaggggtctttctgtggaaaccttcacgaacaatcgttgttttttgatggtt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140122 |
ttgccagaaccaaggggtctttctgtggaaaccttcacgaacaatcgttgttttttgatggtt |
13140060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University