View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5797_high_5 (Length: 323)
Name: NF5797_high_5
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5797_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 311
Target Start/End: Complemental strand, 18644489 - 18644186
Alignment:
| Q |
7 |
gttatcccaactggaatttataaccatgatacaaatagtgacttaagannnnnnnctgcagggtatcattgtttttgcatcagtgatggcaacattggga |
106 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
18644489 |
gttatcccaaccggaatttaaaaccatgatacaaatattgacttaagacgtttta-tgcagggtatcattgtttttgcatcagtgatggcgaccttggga |
18644391 |
T |
|
| Q |
107 |
ttgcagattttgattgagtctggcaggcaaattattgcaaaggtaattgagattagtacttgtttcactatgaatgagtaatcaaagcttttgttttaga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
18644390 |
ttgcagattttgattgagtctggcaggcaaattattgcaaaggtaattgagattagtacttgtttcactgtgaatgagtaat-aaagcttttgttttaga |
18644292 |
T |
|
| Q |
207 |
tattttgtgagccttacttgtaatcttga-ttttttaatgtcttgtttcattctttctcttatagactaaacctgaaatggatcatagtgagttgggatg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18644291 |
tattttgtgagccttacttgtaatcttgatttttttaatgtcttgtttcattctttctcttatagactaaacctgaaatggatcatagtgagttgggatg |
18644192 |
T |
|
| Q |
306 |
gatgat |
311 |
Q |
| |
|
|||||| |
|
|
| T |
18644191 |
gatgat |
18644186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 63 - 153
Target Start/End: Complemental strand, 27309089 - 27308999
Alignment:
| Q |
63 |
tgcagggtatcattgtttttgcatcagtgatggcaacattgggattgcagattttgattgagtctggcaggcaaattattgcaaaggtaat |
153 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||||| || |||||||| ||||||||||||| |
|
|
| T |
27309089 |
tgcagggtatcattgtttttgcatccgtgatggcaaccttgggcttgcagattttgatcgagtccggtcggcaaatttttgcaaaggtaat |
27308999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University