View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5798-Insertion-6 (Length: 158)
Name: NF5798-Insertion-6
Description: NF5798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5798-Insertion-6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 9 - 158
Target Start/End: Original strand, 10051328 - 10051478
Alignment:
| Q |
9 |
agaaaacctg-tataagaataagtacaaatctgatgacagcaagacgctgcatattaagcagttaccaaaacaaacaaatcagtaaaatcagccctatgc |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| | |||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10051328 |
agaaaacctgctataagaataagtacaaatctgatgacagcaacatgctgcatattaaccagttaccaacacaaacaaatcagtaaaatcagccctatgc |
10051427 |
T |
 |
| Q |
108 |
tacaacaattgattcactccaatacagatttttattaagtctccctttgcc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10051428 |
tacaacaattgattcactccaatacagatttttattgagtctccctttgcc |
10051478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University