View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5799-Insertion-5 (Length: 381)
Name: NF5799-Insertion-5
Description: NF5799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5799-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 6e-96; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 9 - 186
Target Start/End: Complemental strand, 39839116 - 39838939
Alignment:
| Q |
9 |
ttttttgccatagtgatgctatgcaatcagctctttcgagaacaacgaagggtaccccttgttctctaagacatgctgccgttgcaagaccagatggacc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39839116 |
ttttttgccatagtgatgctatgcaatcagctctttcgagaacaacgaagggtaccccttgttctctaagacatgctgccgttgcaagaccagatggacc |
39839017 |
T |
|
| Q |
109 |
tgcacctatgatcacaggtccattgacccaaatgcaacggcgtgagagaaagtcttggtgatcagctagacgaaataa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39839016 |
tgcacctatgatcacaggtccattgacccaaatgcaacggcgtgagagaaagtcttggtgatcagctagacgaaataa |
39838939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 245 - 381
Target Start/End: Complemental strand, 39838853 - 39838717
Alignment:
| Q |
245 |
caagtgttacgagttgaaatattgaaacagagaatagnnnnnnnnnnnnnnnnngtgattgagagagaatttgatgaagtttggtttatagaattgataa |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39838853 |
caagtgttacgagttgaaatattgaaacagagaatagtttttttttttttttttgtgattgagagagaatttgatgaagtttggtttatagaattgataa |
39838754 |
T |
|
| Q |
345 |
tgtgagtaatggattgaatgaataaagaggaggagtt |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39838753 |
tgtgagtaatggattgaatgaataaagaggaggagtt |
39838717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 59 - 164
Target Start/End: Original strand, 31290746 - 31290851
Alignment:
| Q |
59 |
ggtaccccttgttctctaagacatgctgccgttgcaagaccagatggacctgcacctatgatcacaggtccattgacccaaatgcaacggcgtgagagaa |
158 |
Q |
| |
|
||||||||||||||||||||||||| || ||| || || ||||||||| ||||| |||||||||| ||||| ||| | ||||||||||| ||||||||| |
|
|
| T |
31290746 |
ggtaccccttgttctctaagacatgttgtcgtcgctaggtcagatggacttgcacatatgatcacacgtccactgaactaaatgcaacggagtgagagaa |
31290845 |
T |
|
| Q |
159 |
agtctt |
164 |
Q |
| |
|
|||||| |
|
|
| T |
31290846 |
agtctt |
31290851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 40 - 173
Target Start/End: Complemental strand, 31290043 - 31289908
Alignment:
| Q |
40 |
tctttcgagaacaacgaa--gggtaccccttgttctctaagacatgctgccgttgcaagaccagatggacctgcacctatgatcacaggtccattgaccc |
137 |
Q |
| |
|
|||||||||||||| ||| | ||| |||||||||||||||| |||||| |||||| || ||||||||| || | | ||||||| |||||| || || |
|
|
| T |
31290043 |
tctttcgagaacaatgaatagagtatcccttgttctctaagatatgctgacgttgctaggtcagatggacttgtgcttttgatcacgggtccaccgagcc |
31289944 |
T |
|
| Q |
138 |
aaatgcaacggcgtgagagaaagtcttggtgatcag |
173 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
31289943 |
aaatgcaacggtgtgagagaaagtcttcatgatcag |
31289908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 314 - 376
Target Start/End: Original strand, 31291016 - 31291078
Alignment:
| Q |
314 |
tttgatgaagtttggtttatagaattgataatgtgagtaatggattgaatgaataaagaggag |
376 |
Q |
| |
|
||||||||| |||||||||| |||||| ||| ||||| |||||||||||||||| |||||| |
|
|
| T |
31291016 |
tttgatgaactttggtttatgaaattgagaatatgagtgttggattgaatgaataaggaggag |
31291078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 9 - 147
Target Start/End: Original strand, 29857914 - 29858052
Alignment:
| Q |
9 |
ttttttgccatagtgatgctatgcaatcagctctttcgagaacaacgaagggtaccccttgttctctaagacatgctgccgttgcaagaccagatggacc |
108 |
Q |
| |
|
|||||||||||||||| |||||||||| | |||||| ||||| | ||||||||| ||||||| ||||||||||||| ||||| ||||| ||||| || |
|
|
| T |
29857914 |
ttttttgccatagtgaagctatgcaatttgatctttcaagaaccatgaagggtactccttgttgcttaagacatgctgctgttgctagacctgatggtcc |
29858013 |
T |
|
| Q |
109 |
tgcacctatgatcacaggtccattgacccaaatgcaacg |
147 |
Q |
| |
|
||| |||| || | ||| ||||| |||||||||||||| |
|
|
| T |
29858014 |
tgctcctactattataggaccatttacccaaatgcaacg |
29858052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University