View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5800-Insertion-10 (Length: 74)
Name: NF5800-Insertion-10
Description: NF5800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5800-Insertion-10 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 9 - 74
Target Start/End: Complemental strand, 16003688 - 16003623
Alignment:
| Q |
9 |
tgttgttgatcaaatattcaccctggttccattttcctccacaagtcgagtcataccgctatttct |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16003688 |
tgttgttgatcaaatattcaccctggttccattttcctccacaagtcgagtcataccgctatttct |
16003623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 6e-24
Query Start/End: Original strand, 9 - 72
Target Start/End: Complemental strand, 26795068 - 26795005
Alignment:
| Q |
9 |
tgttgttgatcaaatattcaccctggttccattttcctccacaagtcgagtcataccgctattt |
72 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26795068 |
tgttgttgatcaaatattcaccctagttccgttttcctccacaagtcgagtcataccgctattt |
26795005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 40722032 - 40721968
Alignment:
| Q |
9 |
tgttgttgatcaaatattcaccctggttccattttcctccacaagtcgagtcataccgctatttc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| | ||||||||||||||||||||||||| |
|
|
| T |
40722032 |
tgttgttgatcaaatattcaccctggtttcgttttccacgacaagtcgagtcataccgctatttc |
40721968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 9e-17
Query Start/End: Original strand, 23 - 74
Target Start/End: Original strand, 27222822 - 27222873
Alignment:
| Q |
23 |
tattcaccctggttccattttcctccacaagtcgagtcataccgctatttct |
74 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27222822 |
tattcaccctggttccgttttcctccacaagtcgagtcatactgctatttct |
27222873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University