View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5800_high_4 (Length: 288)
Name: NF5800_high_4
Description: NF5800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5800_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 5 - 283
Target Start/End: Complemental strand, 43366899 - 43366624
Alignment:
| Q |
5 |
ccatctccgtctgccttctccttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatccttctacttcaattacatt |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366899 |
ccatctccgtctgccttctctttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatccttctacttcaattacatt |
43366800 |
T |
|
| Q |
105 |
cctcattccattctgctgctgtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcaca |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366799 |
cctcattccattttgctgctgtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcaca |
43366700 |
T |
|
| Q |
205 |
ttccggtaatcaaacaatgttctcaccttcnnnnnnnatgcattttttgttatgttgctaatatcttccctttgcttct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43366699 |
ttccggtaatcaaacaatgttctcacctt---tttttattcattttttgttatgttgctaatatcttccttttgtttct |
43366624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University