View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5800_low_7 (Length: 251)
Name: NF5800_low_7
Description: NF5800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5800_low_7 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 32983929 - 32984167
Alignment:
| Q |
13 |
aatatgatatttatagaaaactttggggatgcagtggcttctatgagtctccaaggagatccgctactaagactgagtatgggttgaacccgggagcgtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32983929 |
aatatgatatttatagaaaactttggggatatagtggcttctatgagtctccaaggagatccgccactgagactgagtatgggttgaacccgggagcgtg |
32984028 |
T |
 |
| Q |
113 |
ctcaagctaactgggtggtaaatccgcccctgatcatgttacatactcttggccagcagtagtatgcgacaaggaaggcagtatatatattaattgctta |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32984029 |
cccaagctaactgggtggtaaatccgcccctgatcatgttacatactcttggccagcagtagtatgcgacaaggaaggcagtatatatattaattgctta |
32984128 |
T |
 |
| Q |
213 |
caaacctagaatacacgctatgattattagcatatccat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32984129 |
caaacctagaatacacgctatgattattagcatatccat |
32984167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 85 - 144
Target Start/End: Complemental strand, 6042126 - 6042067
Alignment:
| Q |
85 |
ctgagtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgcccctg |
144 |
Q |
| |
|
|||||||||||| || |||||| |||||| || |||| |||||||||||||||||||||| |
|
|
| T |
6042126 |
ctgagtatgggtagagcccgggcgcgtgcccaggctagctgggtggtaaatccgcccctg |
6042067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 20 - 76
Target Start/End: Original strand, 5232497 - 5232553
Alignment:
| Q |
20 |
tatttatagaaaactttggggatgcagtggcttctatgagtctccaaggagatccgc |
76 |
Q |
| |
|
||||||||||||| || |||| |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
5232497 |
tatttatagaaaagttagggggtgcagtggctcctatgggtctccaaggagatccgc |
5232553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 85 - 144
Target Start/End: Original strand, 7680797 - 7680856
Alignment:
| Q |
85 |
ctgagtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgcccctg |
144 |
Q |
| |
|
||||||| ||||||| |||||| |||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
7680797 |
ctgagtaggggttgagcccgggcgcgtgcccaagctagctgggtggtaaatccgtccctg |
7680856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 144
Target Start/End: Complemental strand, 40702727 - 40702668
Alignment:
| Q |
85 |
ctgagtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgcccctg |
144 |
Q |
| |
|
|||||| |||||||| |||||| | |||| || |||| |||||||||||||||||||||| |
|
|
| T |
40702727 |
ctgagtgtgggttgagcccgggcgtgtgcccaggctagctgggtggtaaatccgcccctg |
40702668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 144
Target Start/End: Original strand, 46279532 - 46279588
Alignment:
| Q |
88 |
agtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgcccctg |
144 |
Q |
| |
|
|||||||||||| ||| || |||||| || |||| |||||||||||||||||||||| |
|
|
| T |
46279532 |
agtatgggttgagcccaggcgcgtgcccaggctagctgggtggtaaatccgcccctg |
46279588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 144
Target Start/End: Complemental strand, 33999961 - 33999902
Alignment:
| Q |
85 |
ctgagtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgcccctg |
144 |
Q |
| |
|
||||| ||||||||| |||||| |||||| || |||| ||||||||||||||||||||| |
|
|
| T |
33999961 |
ctgagcatgggttgagcccgggcgcgtgcccaggctagttgggtggtaaatccgcccctg |
33999902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 141
Target Start/End: Complemental strand, 16594273 - 16594220
Alignment:
| Q |
88 |
agtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgccc |
141 |
Q |
| |
|
||||| |||||| |||||| ||||||||| |||| |||||||||||| |||||| |
|
|
| T |
16594273 |
agtatcggttgagcccgggcgcgtgctcaggctagctgggtggtaaaaccgccc |
16594220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 85 - 146
Target Start/End: Original strand, 30732373 - 30732434
Alignment:
| Q |
85 |
ctgagtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgcccctgat |
146 |
Q |
| |
|
||||||||||||||| ||||| |||||| || |||| ||||||||| ||||||||| |||| |
|
|
| T |
30732373 |
ctgagtatgggttgagcccggacgcgtgcccaggctagctgggtggtgaatccgcccatgat |
30732434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 145
Target Start/End: Complemental strand, 40079588 - 40079528
Alignment:
| Q |
85 |
ctgagtatgggttgaacccgggagcgtgctcaagctaactgggtggtaaatccgcccctga |
145 |
Q |
| |
|
|||||||||| | || |||||| |||||| || |||| |||||||||||||| |||||||| |
|
|
| T |
40079588 |
ctgagtatggatagagcccgggcgcgtgcccaggctagctgggtggtaaatctgcccctga |
40079528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University