View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5801-Insertion-3 (Length: 502)
Name: NF5801-Insertion-3
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5801-Insertion-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 449; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 449; E-Value: 0
Query Start/End: Original strand, 9 - 502
Target Start/End: Complemental strand, 5995350 - 5994857
Alignment:
| Q |
9 |
atggcatcctcggttctctcgtcctcaggcaaatgagccaaagccaaacctgttgcgacacaataaggtgacacacagttcactcttattccgtggttcc |
108 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995350 |
atggcatcctcggttctttcgtcttcaggcaaatgagccaaagccaaacctgttgcgacacaataaggtgacacacagttcactcttattccgtggttcc |
5995251 |
T |
|
| Q |
109 |
ccaattcagctgcaacattctttgttaatccccacacagcatgcttggaacctgtgtatccatgcggtcctacccctcctaaggaacttgctacacttga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5995250 |
ccaattcagctgcaacattctttgttaatccccacacagcatgcttggaacctgtgtatccatgcggtcctaaccctcctaaggaacttgctacacttga |
5995151 |
T |
|
| Q |
209 |
tatagaaattattgagccacttttctttgggatcagatattgagcagcatgtttcattccatggaaaactccctttacatttatgttaaatactttgtcg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995150 |
tatagaaattattgagccacttttctttgggatcagatattgagcagcatgtttcattccatggaaaactccctttacatttatgttaaatactttgtcg |
5995051 |
T |
|
| Q |
309 |
aattctgccatatccacattgcggatatcaggacaaggtgctccggaaattcccgcattgttgaccatgatgtctagagtgccgaatttagcgacagcga |
408 |
Q |
| |
|
|| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995050 |
aactctgccatgtccacgttgcggatatcaggacaaggtgctccggaaattcccgcattgttgaccatgatgtctagagtgccgaatttagcgacagcga |
5994951 |
T |
|
| Q |
409 |
tggatactgcagtggagacatcagcctctacagcgacatcacaatggacgnnnnnnncattttctagatcacttaaggaatcaaagagcttctg |
502 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5994950 |
tggatactgcagtggagacatcagcctctacagcgacatcacaatggacgaaaaaaacattttctagatcacttaaggaatcaaagagcttctg |
5994857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University