View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5801_high_2 (Length: 307)
Name: NF5801_high_2
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5801_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 44166934 - 44167205
Alignment:
| Q |
19 |
gaaactacaaggtcttcttgaatatggcttatgcttgagtgcagacagtgggagtgtttgttggttttgcttgtggtgcgcaagagaactagctttgttg |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44166934 |
gaaactacaaggtcttcttgaatgaggcttatgcttgagtgcagacagtgggagtgtttgttggttttgcttgtggtgtgcaagagaactagctttgttg |
44167033 |
T |
 |
| Q |
119 |
taggttccaatggatattgtagatagtattatattttgatggaaatgaatggcattaatggtgaaacaagagggagattgaaatttggttgtggcaagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44167034 |
taggttccaatggatattgtagatagtattatattttgatggaaatgaatggcattaatggtgaaacaagagggagattgaaatttggttgtggcaagaa |
44167133 |
T |
 |
| Q |
219 |
caaagtatttgaacatgaatagggtattgtgtaatgtccagatgggcgccatttagtgtgcaaccttaaggt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44167134 |
caaagtatttgaacatgaatagggtattgtgtaatgtccagatgggcgccatttagtgtgcaaccttaaggt |
44167205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University