View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5801_low_5 (Length: 238)
Name: NF5801_low_5
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5801_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 155
Target Start/End: Original strand, 4039669 - 4039810
Alignment:
| Q |
14 |
atgaagaaaataatcaaacttcaactgaaatggaatcttcttgtttgtcaagtaatgatggtgatctttttctttggaattcacttgatcttcctcctat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4039669 |
atgaagaaaataatcaaacttcaactgaaatggagtcttcttgtttgtcaagtaatgatggtgatctttttctttggaattcacttgatcttcctcctat |
4039768 |
T |
 |
| Q |
114 |
ttgttttgttaacttacttgaaaatggttcattcaattagta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4039769 |
ttgttttgttaacttacttgaaaatggttcattcaattagta |
4039810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 219
Target Start/End: Original strand, 4039817 - 4039854
Alignment:
| Q |
182 |
ttttcatttgtgatcaatgtatgcttaattgccaagca |
219 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4039817 |
ttttcatttgtgctcaatttatgcttaattgccaagca |
4039854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University